Nufip2^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Nufip2^em1(IMPC)J
• Name: nuclear FMR1 interacting protein 2; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6258455
• Gene: Nufip2 Location: Chr11:77576566-77608792 bp, + strand Genetic Position: Chr11, 46.74 cM
• Alliance: Nufip2^em1(IMPC)J page
• IMPC: Nufip2 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CCTACAATACAGCTTAGTAT and GGATAGCCTTTTTTTGTATT, which resulted in a 2080 bp deletion beginning at Chromosome 11 position 77,691,456 bp and ending after 77,693,535 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000292192 (exon 2) and 367 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 93 delete 571 amino acids and stop 28 amino acids later. This transcript does not go out of frame but removes >80% of the coding sequence. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Nufip2 Mutation: 53 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)