Dhx37^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Dhx37^em1(IMPC)J
• Name: DEAH-box helicase 37; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6258465
• Synonyms: Dhx37^-
• Gene: Dhx37 Location: Chr5:125490922-125511185 bp, - strand Genetic Position: Chr5, 64.2 cM
• Alliance: Dhx37^em1(IMPC)J page
• IMPC: Dhx37 gene page

Dhx37^em1(IMPC)J/Dhx37^em1(IMPC)J mice exhibit embryonic lethality, with embryos recovered at E3.5 but not at E7.5. Embryos at E3.5 appear as dying morulae. Mutants fail to hatch from the zona pellucida and never reach blastocyst stage in culture.

Show the 1 phenotype image(s) involving this allele.

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 4 guide sequences AAAACTGCCGTGGATCTCAA, AGACGAACAGAGTCTCACTA, GCACCAGCTCTCCAGATCAG and ATATTTGTCATGAGTAAGCA, which resulted in a 232 bp deletion beginning at Chromosome 5 position 125,431,557 bp and ending after 125,431,788 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001016994 (exon 2) and 62 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 34 and early truncation 9 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Dhx37 Mutation: 39 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 4 reference(s)