Klhl22^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Klhl22^em1(IMPC)J
• Name: kelch-like 22; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6258564
• Gene: Klhl22 Location: Chr16:17577485-17611246 bp, + strand Genetic Position: Chr16, 11.01 cM
• Alliance: Klhl22^em1(IMPC)J page
• IMPC: Klhl22 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CCTCCAGCTAAGACTTGAGT and TTCAGGGTACACGTTATCAA, which resulted in an 861 bp deletion beginning at Chromosome 16 position 17,776,376 bp and ending after 17,777,236 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000130069 (exon 4) and 142 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 131 and early truncation 1 amino acid later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Klhl22 Mutation: 34 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)