Klhl32^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Klhl32^em1(IMPC)J
• Name: kelch-like 32; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6258585
• Gene: Klhl32 Location: Chr4:24612554-24851124 bp, - strand Genetic Position: Chr4, 10.42 cM
• Alliance: Klhl32^em1(IMPC)J page
• IMPC: Klhl32 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCCGTGAGCCAACTACATGG and GTAGCCTCCCCAAAGCCCAA, which resulted in a 342 bp deletion beginning at Chromosome 4 position 24,792,530 bp and ending after 24,792,871 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001221273 (exon 3) and 161 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 7 and early truncation 15 amino acids later. There is an additional 11 bp deletion (CTGGACAGAAC) 40 bp after the large deletion. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Klhl32 Mutation: 31 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)