About   Help   FAQ
Klhl24em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Klhl24em1(IMPC)J
Name: kelch-like 24; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6258591
Gene: Klhl24  Location: Chr16:19916292-19947971 bp, + strand  Genetic Position: Chr16, 12.36 cM, cytoband B1
Alliance: Klhl24em1(IMPC)J page
IMPC: Klhl24 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCAGATATGCTGAACAGTAC and GTAAGTATTCTTGCTTTCAA, which resulted in a 476 bp deletion beginning at Chromosome 16 position 20,114,420 bp and ending after 20,114,895 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000130712 (exon 4) and 291 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 307 and early truncation 6 amino acids later. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Klhl24 Mutation:  35 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/10/2024
MGI 6.24
The Jackson Laboratory