Polr2l^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Polr2l^em1(IMPC)J
• Name: polymerase (RNA) II (DNA directed) polypeptide L; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6258608
• Gene: Polr2l Location: Chr7:141051773-141055045 bp, - strand Genetic Position: Chr7, 86.83 cM
• Alliance: Polr2l^em1(IMPC)J page
• IMPC: Polr2l gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AGAGTCTGTAGGCCTTGCTA and CTATCCACACGAATACCCAG, which resulted in a 1828 bp deletion beginning at Chromosome 7 position 141,471,653 bp and ending after 141,473,480 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000668186 (exon 2) and 283 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 32 and immediate truncation probably due to run on into the intron. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Polr2l Mutation: 12 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)