Cr2^em1Llp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Cr2^em1Llp
• Name: complement receptor 2; endonuclease-mediated mutation 1, Luanne Peters
• MGI ID: MGI:6259110
• Gene: Cr2 Location: Chr1:194819119-194859024 bp, - strand Genetic Position: Chr1, 98.44 cM
• Alliance: Cr2^em1Llp page
• IMPC: Cr2 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated by Dr. Luanne Peters at The Jackson Laboratory by microinjection of Cas9 mRNA and 4 guide sequences, GTTGACCAGTTTGTTGCG, GTACTTCTCCTGTAATGAA, GCACACATGGGATCCTT, and GTTCTTGGTGAGCTGGGCAC, which resulted in a 60 bp deletion beginning at approximately Chromosome 1 position 195176543 bp, CTTGGG, and ending after 195176602 bp, GCTGGG (GRCm38.p4/mm10). This mutation deletes most of exon 1 and some of the downstream intron. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Cr2 Mutation: 84 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 1 reference(s)