Ttc38^em1Llp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ttc38^em1Llp
• Name: tetratricopeptide repeat domain 38; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6259151
• Gene: Ttc38 Location: Chr15:85716545-85743023 bp, + strand Genetic Position: Chr15, 40.42 cM
• Alliance: Ttc38^em1Llp page
• IMPC: Ttc38 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated by Dr. Luanne Peters at The Jackson Laboratory by microinjection of Cas9 mRNA and 2 guide sequences, GCTCTCATTTCATGTACGT, GCAATCGGAAGGTCACTGGA, which resulted in a 62 bp deletion beginning at approximately Chromosome 15 position 85,844,505 bp, ACATGAAA, and ending after 85,844,566 bp, GGTCACT (GRCm38.p6/mm10). This mutation deletes much of ENSMUSE00001278296 (exon 7). (J:188991)
• Inheritance: Not Specified

Phenotypes

Key:

hm	homozygous	ht	heterozygous	tg	involves transgenes	√	phenotype observed
cn	conditional genotype	cx	complex: > 1 genome feature	ot	other: hemizygous, indeterminate,...	N	normal phenotype

Genotype/
Background:

	Allelic Composition	Genetic Background	Cell Line(s)
Loading...
hm1	Ttc38^em1Llp/Ttc38^em1Llp	C57BL/6NJ-Ttc38^em1Llp/J

Phenotypes:

Affected Systems	hm1
show or hide all annotated terms Sex:
Source:	IMPC - JAX
homeostasis/metabolism	√
impaired glucose tolerance	√

View phenotypes and curated references for all genotypes (concatenated display).

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Ttc38 Mutation: 26 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)