Ppp1r12b^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ppp1r12b^em1(IMPC)J
• Name: protein phosphatase 1, regulatory subunit 12B; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6259156
• Gene: Ppp1r12b Location: Chr1:134682396-134883680 bp, - strand Genetic Position: Chr1, 58.24 cM, cytoband F
• Alliance: Ppp1r12b^em1(IMPC)J page
• IMPC: Ppp1r12b gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AAGTAGCCAGACAGCATGCC and ATCTCTACAGTGCTGTAAAT, which resulted in a 581 bp deletion beginning at Chromosome 1 position 134,902,144 bp and ending after 134,902,724 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001237379 (exon 2) and 450 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 97 and early truncation 3 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

7 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Ppp1r12b Mutation: 75 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 4 reference(s)