Haus4^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Haus4^em1(IMPC)J
• Name: HAUS augmin-like complex, subunit 4; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6259158
• Synonyms: Haus4^-
• Gene: Haus4 Location: Chr14:54779242-54792073 bp, - strand Genetic Position: Chr14, 27.83 cM
• Alliance: Haus4^em1(IMPC)J page
• IMPC: Haus4 gene page

Haus4^em1(IMPC)J/Haus4^em1(IMPC)J mice exhibit embryonic lethality, with embryos recovered at E3.5 that appear as morulae, but no embryos at E7.5. Mutants hatch from the zona and form irregular outgrowths with trophectoderm and primitive endoderm cells but small/no inner cell mass colony.

Show the 1 phenotype image(s) involving this allele.

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GAGGGCACATGAGCAGGCCG and GCACACAGACTGTTAGCACG, which resulted in a 137 bp deletion beginning at Chromosome 14 position 54,545,708 bp and ending after 54,545,844 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000124158 (exon 6) and 40 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 155 and early truncation 6 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Haus4 Mutation: 24 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 4 reference(s)