Fam222a^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Fam222a^em1(IMPC)J
• Name: family with sequence similarity 222, member A; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6259165
• Gene: Fam222a Location: Chr5:114706312-114751281 bp, + strand Genetic Position: Chr5, 55.99 cM
• Alliance: Fam222a^em1(IMPC)J page
• IMPC: Fam222a gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TTAGGTTTTGGTCCAGAAGT and TTGCCCCTATGGATGGACCA, which resulted in a 2716 bp deletion beginning at Chromosome 5 position 114,610,703 bp and ending after 114,613,418 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000389063 (exon 3) and 322 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause an early truncation after 29 amino acids. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Fam222a Mutation: 17 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)