Snx6^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Snx6^em1(IMPC)J
• Name: sorting nexin 6; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6259581
• Gene: Snx6 Location: Chr12:54793124-54842464 bp, - strand Genetic Position: Chr12, 23.46 cM
• Alliance: Snx6^em1(IMPC)J page
• IMPC: Snx6 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GATGACTGAGGCCTTATAAA and GTTCGTTAAAGTTAGTTATT, which resulted in a 391 bp deletion beginning at Chromosome 12 position 54,770,473 bp and ending after 54,770,863 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000532238 (exon 5) and 269 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause an early truncation after amino acid 90. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Snx6 Mutation: 62 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)