Spc25^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Spc25^em1(IMPC)J
• Name: SPC25, NDC80 kinetochore complex component, homolog (S. cerevisiae); endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6259583
• Gene: Spc25 Location: Chr2:69024239-69036538 bp, - strand Genetic Position: Chr2, 39.64 cM, cytoband C3
• Alliance: Spc25^em1(IMPC)J page
• IMPC: Spc25 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 4 guide sequences ATTACACTCTCAGCCTTTAG, AGGTTGACTTTGCTACAGAA, GGGCCCCAAATACATCTATG and CAGACATAAACTCGAAAATG, which resulted in an 8330 bp deletion beginning at Chromosome 2 position 69,196,943 bp and ending after 69,205,272 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001291289-ENSMUSE00000165579 (exons 2-6) and 7760 bp of flanking intronic sequence including the start site and splice acceptors and donors and is predicted to result in a null allele. In addition, there is a 57 bp insertion at the deletion site (Chr2:69,196,929-69,196,985). (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Spc25 Mutation: 19 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)