Ier5l^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ier5l^em1(IMPC)J
• Name: immediate early response 5-like; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6259585
• Gene: Ier5l Location: Chr2:30362643-30364211 bp, - strand Genetic Position: Chr2, 21.71 cM, cytoband B
• Alliance: Ier5l^em1(IMPC)J page
• IMPC: Ier5l gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TGGATACCCCCATATCCGCA and CGGAGGCTCCTAGTCCCACG, which resulted in a 3057 bp deletion beginning at Chromosome 2 position 30,471,400 bp and ending after 30,474,456 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000462138 (exon 1) and 374 bp of flanking intronic sequence including the transcription start site and is predicted to result in a null allele. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

4 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Ier5l Mutation: 9 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)