About   Help   FAQ
Tex36em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Tex36em1(IMPC)J
Name: testis expressed 36; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6259893
Gene: Tex36  Location: Chr7:133188753-133203844 bp, - strand  Genetic Position: Chr7, 77.09 cM, cytoband F4
Alliance: Tex36em1(IMPC)J page
IMPC: Tex36 gene page
Mutation
origin
Strain of Origin:  Not Specified
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGTCTTTTCACCTGTCAAGA and GGACAATGCTGAATCCATGA, which resulted in a 571 bp deletion beginning at Chromosome 7 position 133,601,825 bp and ending after 133,602,395 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000205104 (exon 1) and 380 bp of flanking intronic sequence including the translation start site and splice donor and is predicted to cause a null allele. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Tex36 Mutation:  18 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/18/2025
MGI 6.24
The Jackson Laboratory