Wdr18^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Wdr18^em1(IMPC)J
• Name: WD repeat domain 18; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6259989
• Gene: Wdr18 Location: Chr10:79795989-79805081 bp, + strand Genetic Position: Chr10, 39.72 cM
• Alliance: Wdr18^em1(IMPC)J page
• IMPC: Wdr18 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTGTCCTTCCACTACTTGGG and GACACAGTATGCCTTCAGAC, which resulted in a 2235 bp deletion beginning at Chromosome 10 position 79,964,652 bp and ending after 79,966,886 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000314370-ENSMUSE00000314328 (exons 3-8) and 1458 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 108 removing 258 amino acids and to retain the last 65 amino acids before the stop. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Wdr18 Mutation: 23 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)