Thoc7^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Thoc7^em1(IMPC)J
• Name: THO complex 7; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6260024
• Synonyms: Thoc7^-
• Gene: Thoc7 Location: Chr14:8507911-8520751 bp, + strand Genetic Position: Chr14, 7.08 cM, cytoband A2
• Alliance: Thoc7^em1(IMPC)J page
• IMPC: Thoc7 gene page

Thoc7^em1(IMPC)J/Thoc7^em1(IMPC)J mice exhibit embryonic lethality, with embryos recovered at E3.5 as blastocysts but not at E7.5. Blastocysts grown in vitro hatch from the zona pellucida and form irregular outgrowths.

Show the 1 phenotype image(s) involving this allele.

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGCCTTAATAAAGTTCCACC and GGTATATCTGCCTGTCCTAG, which resulted in a 569 bp deletion beginning at Chromosome 14 position 13,954,335 bp and ending after 13,954,903 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000517611 (exon 2) and 451 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 6 and early truncation 8 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Thoc7 Mutation: 17 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 4 reference(s)