Tspyl4^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Tspyl4^em1(IMPC)J
• Name: TSPY-like 4; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6260179
• Gene: Tspyl4 Location: Chr10:34173438-34177316 bp, + strand Genetic Position: Chr10, 18.85 cM, cytoband B1
• Alliance: Tspyl4^em1(IMPC)J page
• IMPC: Tspyl4 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GATTGCCAGTTCTCGCGCTA and GTCTGGGTGAATGTACAGTT, which resulted in a 3982 bp deletion beginning at Chromosome 10 position 34,297,362 bp and ending after 34,301,343 bp (GRCm38/mm10) with a single base pair insertion (C) at the deletion site. This mutation deletes ENSMUSE00000316800 (exon 1) and 103 bp of flanking intronic sequence including the entire coding sequence and is predicted to generate a null allele. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Tspyl4 Mutation: 18 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)