Scn11a^em1(IMPC)H
Endonuclease-mediated Allele Detail

Summary

• Symbol: Scn11a^em1(IMPC)H
• Name: sodium channel, voltage-gated, type XI, alpha; endonuclease-mediated mutation 1, Harwell
• MGI ID: MGI:6266832
• Gene: Scn11a Location: Chr9:119582829-119654522 bp, - strand Genetic Position: Chr9, 71.33 cM, cytoband F3-F4
• Alliance: Scn11a^em1(IMPC)H page
• IMPC: Scn11a gene page

Mutation origin

• Strain of Origin: C57BL/6NTac
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from IMPC was generated at Medical Research Council Harwell by injecting CAS9 RNA and 4 guide sequences CTAACCTTCAAACGACTACAGGG, CCTAGCATCTTGAAGCCCCGTGT, CCACTAAACTGGAACTGGTTGGG, CCTTCAAACGACTACAGGGGCTG, which resulted in a Exon Deletion. (J:265051)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 3 strains available Cell Lines: 0 lines available
• Carrying any Scn11a Mutation: 88 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 3 reference(s)