Arhgap20^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Arhgap20^em1(IMPC)J
• Name: Rho GTPase activating protein 20; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6266926
• Gene: Arhgap20 Location: Chr9:51676651-51765158 bp, + strand Genetic Position: Chr9, 28.62 cM
• Alliance: Arhgap20^em1(IMPC)J page
• IMPC: Arhgap20 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ATTGACAATGTTATCAAGAT and GCGTGTGTCCTATAGAAGGC, which resulted in a 301 bp deletion beginning at Chromosome 9 position 51,825,735 bp and ending after 51,826,035 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001216120 (exon 6) and 216 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 181 and early truncation 4 amino acids later. (J:188991)
• Inheritance: Not Specified

Phenotypes

Key:

hm	homozygous	ht	heterozygous	tg	involves transgenes	√	phenotype observed
cn	conditional genotype	cx	complex: > 1 genome feature	ot	other: hemizygous, indeterminate,...	N	normal phenotype

Genotype/
Background:

	Allelic Composition	Genetic Background	Cell Line(s)
Loading...
hm1	Arhgap20^em1(IMPC)J/Arhgap20^em1(IMPC)J	C57BL/6NJ-Arhgap20^em1(IMPC)J/Mmjax

Phenotypes:

Affected Systems	hm1
show or hide all annotated terms Sex:
Source:	IMPC - JAX
homeostasis/metabolism	√
abnormal cholesterol homeostasis	√

View phenotypes and curated references for all genotypes (concatenated display).

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Arhgap20 Mutation: 53 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)