E130114P18Rik^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: E130114P18Rik^em1(IMPC)J
• Name: RIKEN cDNA E130114P18 gene; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6266929
• Gene: E130114P18Rik Location: Chr4:97456112-97472828 bp, - strand Genetic Position: Chr4, 45.43 cM
• Alliance: E130114P18Rik^em1(IMPC)J page
• IMPC: E130114P18Rik gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ATTTACAAAGGAGATACGCA and CTGATTGTATGATAACGCAA, which resulted in a 425 bp deletion beginning at Chromosome 4 position 97,574,571 bp and ending after 97,574,995 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001276782 (exon 4) and 322 bp of flanking intronic sequence including the splice acceptor and donor. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any E130114P18Rik Mutation: 10 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)