Ssu72^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ssu72^em1(IMPC)J
• Name: Ssu72 RNA polymerase II CTD phosphatase homolog (yeast); endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6267327
• Gene: Ssu72 Location: Chr4:155789272-155818336 bp, + strand Genetic Position: Chr4, 87.07 cM, cytoband E2
• Alliance: Ssu72^em1(IMPC)J page
• IMPC: Ssu72 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCCCTAACATGGGAAGCACA and ATACAGGTCAGAGGATGTGG, which resulted in a 439 bp deletion beginning at Chromosome 4 position 155,731,135 bp and ending after 155,731,573 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000184815 (exon 3) and 299 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 75 and early truncation 23 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Ssu72 Mutation: 73 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)