Myh13^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Myh13^em1(IMPC)J
• Name: myosin, heavy polypeptide 13, skeletal muscle; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6269385
• Gene: Myh13 Location: Chr11:67217929-67262413 bp, + strand Genetic Position: Chr11, 40.85 cM
• Alliance: Myh13^em1(IMPC)J page
• IMPC: Myh13 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CTAGAATCAGGTTAACCAAG and ATTATAGTAGTCATGGTGAA, which resulted in a 738 bp deletion beginning at Chromosome 11 position 67,328,779 bp and ending after 67,329,516 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000578946 and ENSMUSE00001022684 (exons 2 and 3) and 437 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 68 and early truncation 7 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Myh13 Mutation: 96 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)