Vkorc1l1^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Vkorc1l1^em1(IMPC)J
• Name: vitamin K epoxide reductase complex, subunit 1-like 1; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6269386
• Gene: Vkorc1l1 Location: Chr5:129970950-130015533 bp, + strand Genetic Position: Chr5, 68.26 cM
• Alliance: Vkorc1l1^em1(IMPC)J page
• IMPC: Vkorc1l1 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TCCATGACTGATTTGCGCAA and TTTACTATGAAGACACACTA, which resulted in a 325 bp deletion beginning at Chromosome 5 position 129,978,373 bp and ending after 129,978,697 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000410731 (exon 2) and 215 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 65 and early truncation 62 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Vkorc1l1 Mutation: 22 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)