Syt8^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Syt8^em1(IMPC)J
• Name: synaptotagmin VIII; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6272647
• Gene: Syt8 Location: Chr7:141988587-141994133 bp, + strand Genetic Position: Chr7, 87.93 cM, cytoband F5
• Alliance: Syt8^em1(IMPC)J page
• IMPC: Syt8 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCTACTACTGTAGCTTCCAA and CTAGGCCTTTCCCTGAAAAA, which resulted in a 1829 bp deletion beginning at Chromosome 7 position 142,438,739 bp and ending after 142,440,567 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001253691 through ENSMUSE00000668076 (exons 4-9) and 834 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 97 and early truncation 44 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Syt8 Mutation: 11 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)