About   Help   FAQ
Zfp113em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Zfp113em1(IMPC)J
Name: zinc finger protein 113; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6272651
Gene: Zfp113  Location: Chr5:138137964-138154006 bp, - strand  Genetic Position: Chr5, 76.97 cM, cytoband G1
Alliance: Zfp113em1(IMPC)J page
IMPC: Zfp113 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GATGGACAGAATTAGAATTT and GGTAGATTGATTCCTAGCCC, which resulted in a 186 bp deletion beginning at Chromosome 5 position 138,151,134 bp and ending after 138,151,319 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001226474 (exon 3) and 94 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 18 and early truncation 5 amino acids later. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Zfp113 Mutation:  26 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/10/2024
MGI 6.24
The Jackson Laboratory