4930579F01Rik^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: 4930579F01Rik^em1(IMPC)J
• Name: RIKEN cDNA 4930579F01 gene; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6272669
• Gene: 4930579F01Rik Location: Chr3:137869839-137899592 bp, - strand Genetic Position: Chr3, 64.1 cM, cytoband H2
• Alliance: 4930579F01Rik^em1(IMPC)J page
• IMPC: 4930579F01Rik gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ACTTTAATAGAGCTGTAAAA and GTTTCCTCACATGCACACAT, which resulted in a 322 bp deletion beginning at Chromosome 3 position 138,179,375 bp and ending after 138,179,696 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000240313 (exon 3) and 257 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 90 and early truncation 1 amino acid later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any 4930579F01Rik Mutation: 21 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)