Mroh2b^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Mroh2b^em1(IMPC)J
• Name: maestro heat-like repeat family member 2B; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6273151
• Gene: Mroh2b Location: Chr15:4928219-4991687 bp, + strand Genetic Position: Chr15, 1.98 cM, cytoband A1
• Alliance: Mroh2b^em1(IMPC)J page
• IMPC: Mroh2b gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences AGTGGTTTCCTTCAGACCCA and GCTTTAATAGCTTAAAGTAT, which resulted in a 1100 bp deletion beginning at Chromosome 15 position 4,904,805 bp and ending after 4,905,904 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000124014 and ENSMUSE00000124016 (exons 5 and 6) and 846 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 116 and early truncation 5 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Mroh2b Mutation: 104 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)