Abcc8^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Abcc8^em1(IMPC)J
• Name: ATP-binding cassette, sub-family C member 8; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6273498
• Gene: Abcc8 Location: Chr7:45753952-45829441 bp, - strand Genetic Position: Chr7, 29.66 cM
• Alliance: Abcc8^em1(IMPC)J page
• IMPC: Abcc8 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences TTAGGCACATATGAGACGCA and CTGCAGGCCGGTCCTAAGCA, which resulted in a 406 bp deletion beginning at Chromosome 7 position 46,178,322 bp and ending after 46,178,727 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001040856 (exon 2) and 264 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause early truncation after amino acid 50. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Abcc8 Mutation: 78 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)