Pole3^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Pole3^em1(IMPC)J
• Name: polymerase (DNA directed), epsilon 3 (p17 subunit); endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6273618
• Gene: Pole3 Location: Chr4:62440889-62443305 bp, - strand Genetic Position: Chr4, 33.17 cM, cytoband C1
• Alliance: Pole3^em1(IMPC)J page
• IMPC: Pole3 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences CATACAATGTGCTTTTGCAA and CCACTCTGACAGCTTCTGAA, which resulted in a 1834 bp deletion beginning at Chromosome 4 position 62,522,627 bp and ending after 62,524,460 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001250923 and ENSMUSE00001277871 (exons 3 and 4) and 253 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 50 and early truncation 1 amino acid later. In addition, there is a 2 bp (CT) insertion at the deletion site. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Pole3 Mutation: 14 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)