Nphp3^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Nphp3^em1(IMPC)J
• Name: nephronophthisis 3 (adolescent); endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6273809
• Gene: Nphp3 Location: Chr9:103879743-103921010 bp, + strand Genetic Position: Chr9, 56.11 cM
• Alliance: Nphp3^em1(IMPC)J page
• IMPC: Nphp3 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTGCCACCAAGTTTTCAGGG and CGAGCATCCATACAGCTCTG, which resulted in a 261 bp deletion beginning at Chromosome 9 position 104,005,379 bp and ending after 104,005,639 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001248887 (exon 3) and 110 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 169 and early truncation 19 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Nphp3 Mutation: 77 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)