Abhd14b^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Abhd14b^em1(IMPC)J
• Name: abhydrolase domain containing 14b; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6274308
• Gene: Abhd14b Location: Chr9:106324936-106330122 bp, + strand Genetic Position: Chr9, 57.53 cM, cytoband F1
• Alliance: Abhd14b^em1(IMPC)J page
• IMPC: Abhd14b gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ACTGGGTGTTACGTGAACCT and GCCCACAGTGGCAGTCCCAA, which resulted in a 1906 bp deletion beginning at Chromosome 9 position 106,451,319 bp and ending after 106,453,224 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001374711 and ENSMUSE00000345857 (exons 3 and 4) and 724 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 71 and early truncation 33 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Abhd14b Mutation: 22 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)