Fbxw10^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Fbxw10^em1(IMPC)Tcp
• Name: F-box and WD-40 domain protein 10; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:6274925
• Gene: Fbxw10 Location: Chr11:62737895-62768291 bp, + strand Genetic Position: Chr11, 38.78 cM
• Alliance: Fbxw10^em1(IMPC)Tcp page
• IMPC: Fbxw10 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project TCPR1239 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of TCAGGAGATTCGACTTCAGG and TAGAATATTCAGCGGCCTAG targeting the 5' side and ATATGGATAAGGCGACATTT and ATCCCATCAGGCTGGCTGAA targeting the 3' side of a critical region. This resulted in a 757-bp del Chr11: 62852806 to 62853562 (GRCm38). (J:265051)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Fbxw10 Mutation: 61 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 3 reference(s)