Plek2^em1(IMPC)Tcp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Plek2^em1(IMPC)Tcp
• Name: pleckstrin 2; endonuclease-mediated mutation 1, The Centre for Phenogenomics
• MGI ID: MGI:6274931
• Gene: Plek2 Location: Chr12:78935465-78953738 bp, - strand Genetic Position: Chr12, 35.51 cM, cytoband D3
• Alliance: Plek2^em1(IMPC)Tcp page
• IMPC: Plek2 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from project TCPR1235 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of ATCCTCTAATTGGACACCTT and CTGACTACCTATGAGTGCAA targeting the 5' side and GCACTCTGTCTTAAGCGGAA and GTAATGGTCACCTGTTTGGT targeting the 3' side of a critical region. This resulted in a 1141-bp del Chr12:78895781 to 78896921 (GRCm38). (J:265051)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Plek2 Mutation: 17 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 3 reference(s)