C2cd2l^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: C2cd2l^em1(IMPC)J
• Name: C2 calcium-dependent domain containing 2-like; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6275144
• Gene: C2cd2l Location: Chr9:44220534-44231579 bp, - strand Genetic Position: Chr9, 24.84 cM, cytoband B
• Alliance: C2cd2l^em1(IMPC)J page
• IMPC: C2cd2l gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GATTGGTGCACAGCATGCCG and AACAGTGTCAGGCACTGCGG, which resulted in a 1299 bp deletion beginning at Chromosome 9 position 44,315,851 bp and ending after 44,317,149 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000216722-ENSMUSE00000216734 (exons 3-7) and 730 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 150 and early truncation 22 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any C2cd2l Mutation: 33 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)