About   Help   FAQ
Adi1em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Adi1em1(IMPC)J
Name: acireductone dioxygenase 1; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6275158
Gene: Adi1  Location: Chr12:28725230-28732174 bp, + strand  Genetic Position: Chr12, 11.05 cM
Alliance: Adi1em1(IMPC)J page
IMPC: Adi1 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCAGAACTGGAATTTCCACC and GCGAGGCAGCATTATCTACA, which resulted in a 2357 bp deletion beginning at Chromosome 12 position 28,677,511 bp and ending after 28,679,867 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000107236 and ENSMUSE00000107235 (exons 2 and 3) and 2057 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 40, remove 100 amino acids and retain the last 39 amino acids before the stop. In addition there is a 20 bp AGATACTTATGCTGCCTAGC insertion at the deletion site. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Adi1 Mutation:  12 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/25/2025
MGI 6.24
The Jackson Laboratory