Ccdc107^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ccdc107^em1(IMPC)J
• Name: coiled-coil domain containing 107; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6275206
• Gene: Ccdc107 Location: Chr4:43493365-43495921 bp, + strand Genetic Position: Chr4, 23.04 cM
• Alliance: Ccdc107^em1(IMPC)J page
• IMPC: Ccdc107 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GGAATGTGAAACTCTCCAGT and CGGTAGCCTCAGAAACACAA, which resulted in a 1098 bp deletion beginning at Chromosome 4 position 43,494,976 bp and ending after 43,496,073 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001230953, ENSMUSE00000179397, ENSMUSE00000179398, and ENSMUSE00000179395 (exons 3-6) and 608 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 86 and early truncation 56 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Ccdc107 Mutation: 14 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)