4933402J07Rik^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: 4933402J07Rik^em1(IMPC)J
• Name: RIKEN cDNA 4933402J07 gene; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6275630
• Gene: 4933402J07Rik Location: Chr8:88290535-88315825 bp, + strand Genetic Position: Chr8, 42.21 cM
• Alliance: 4933402J07Rik^em1(IMPC)J page
• IMPC: 4933402J07Rik gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCCTCCTATTTAGAGACAGT and GGTTGTTAGGGAATCACCCA, which resulted in a 950 bp deletion beginning at Chromosome 8 position 87,567,814 bp and ending after 87,568,763 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000581161 and ENSMUSE00000581160 (exons 2 and 3) and 721 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 49 and early truncation 13 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any 4933402J07Rik Mutation: 16 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)