About   Help   FAQ
Cox16em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Cox16em1(IMPC)J
Name: cytochrome c oxidase assembly protein 16; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6276283
Gene: Cox16  Location: Chr12:81405800-81531901 bp, - strand  Genetic Position: Chr12, 37.6 cM, cytoband D2
Alliance: Cox16em1(IMPC)J page
IMPC: Cox16 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences, GTAACACGCGCGTTCACGAA and GCTAATGCACAAGTAGCACC, which resulted in a 645 bp deletion beginning at Chromosome 12 position 81,484,671 bp and ending after 81,485,315 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000912604 (exon 1) and 421 bp of flanking intronic sequence including the translation start site and is predicted to generate a null allele. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Cox16 Mutation:  20 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/17/2024
MGI 6.24
The Jackson Laboratory