About   Help   FAQ
Ccdc51em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Ccdc51em1(IMPC)J
Name: coiled-coil domain containing 51; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6276291
Gene: Ccdc51  Location: Chr9:108911561-108921557 bp, + strand  Genetic Position: Chr9, 59.63 cM
Alliance: Ccdc51em1(IMPC)J page
IMPC: Ccdc51 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GTTCTGTCAGTGGTTATTCG and ATTGCTTCCCGTGAATAAAA, which resulted in a 1297 bp deletion beginning at Chromosome 9 position 109,091,430 bp and ending after 109,092,726 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000352186 (exon 4) and 322 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 156 and early truncation 9 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Ccdc51 Mutation:  25 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
06/12/2024
MGI 6.13
The Jackson Laboratory