Taf12^em1(IMPC)Mbp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Taf12^em1(IMPC)Mbp
• Name: TATA-box binding protein associated factor 12; endonuclease-mediated mutation 1, Mouse Biology Program, UC Davis
• MGI ID: MGI:6276947
• Synonyms: Taf12^-
• Gene: Taf12 Location: Chr4:132001667-132020640 bp, + strand Genetic Position: Chr4, 65.09 cM
• Alliance: Taf12^em1(IMPC)Mbp page
• IMPC: Taf12 gene page

Taf12^em1(IMPC)Mbp/Taf12^em1(IMPC)Mbp mice exhibit embryonic lethality, with embryos recovered at E3.5 as blastocysts but not at E7.5. Blastocysts in vitro hatch from the zona pellucida but outgrowths lack an obvious inner cell mass colony.

Show the 1 phenotype image(s) involving this allele.

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from IMPC was generated at UC Davies by injecting CAS9 Protein and 2 guide sequences CCTTCAGCGCTAATCAACCTCTC, CCGTGGGGAAGATAGCAGGCACT, which resulted in an Intra-exdel deletion. A 90bp deletion of bases 23 to 113 of the protein coding sequence was verified by RNA sequencing. This alteration is predicted to cause early truncation after 7 amino acids. Although mutant mRNA is produced, a mutant protein likely retains no TAF12 functions based on early missense amino acids and early termination. (J:265051, J:348275)
• Inheritance: Not Specified

Expression

In Mice Carrying this Mutation:	40 assay results
In Structures Affected by this Mutation:	3 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Taf12 Mutation: 16 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 5 reference(s)