Rbm10^em1(IMPC)Mbp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rbm10^em1(IMPC)Mbp
• Name: RNA binding motif protein 10; endonuclease-mediated mutation 1, Mouse Biology Program, UC Davis
• MGI ID: MGI:6276949
• Gene: Rbm10 Location: ChrX:20483742-20517140 bp, + strand Genetic Position: ChrX, 16.11 cM
• Alliance: Rbm10^em1(IMPC)Mbp page
• IMPC: Rbm10 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from IMPC was generated at UC Davies by injecting CAS9 Protein and 2 guide sequences CCTACTGCCAGGCACTAGCGCTC, CCCCAGTAGCCTCATAGACCAGC, which resulted in a Exon Deletion. (J:265051)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

5 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Rbm10 Mutation: 22 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 3 reference(s)