Nox4^em1(IMPC)Mbp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Nox4^em1(IMPC)Mbp
• Name: NADPH oxidase 4; endonuclease-mediated mutation 1, Mouse Biology Program, UC Davis
• MGI ID: MGI:6276965
• Gene: Nox4 Location: Chr7:86895304-87047918 bp, + strand Genetic Position: Chr7, 48.96 cM
• Alliance: Nox4^em1(IMPC)Mbp page
• IMPC: Nox4 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from IMPC was generated at UC Davies by injecting CAS9 Protein and 2 guide sequences TTCAGAGACTAGTTATGCCACGG, GAGACTTACTCCAGGCTTAAAGG, which resulted in a Exon Deletion. (J:265051)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

2 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Nox4 Mutation: 68 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 3 reference(s)