Nup155^em1(IMPC)Mbp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Nup155^em1(IMPC)Mbp
• Name: nucleoporin 155; endonuclease-mediated mutation 1, Mouse Biology Program, UC Davis
• MGI ID: MGI:6276986
• Synonyms: Nup155^-
• Gene: Nup155 Location: Chr15:8138757-8190731 bp, + strand Genetic Position: Chr15, 3.82 cM, cytoband A2
• Alliance: Nup155^em1(IMPC)Mbp page
• IMPC: Nup155 gene page

Nup155^em1(IMPC)Mbp/Nup155^em1(IMPC)Mbp mice exhibit embryonic lethality, with embryos recovered at E3.5 as early blastocysts but not at E7.5. Blastocysts grown in vitro do not hatch from the zona pellucida or form outgrowths.

Show the 1 phenotype image(s) involving this allele.

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from IMPC was generated at UC Davies by injecting CAS9 Protein and 2 guide sequences CCTCGACTGCTTGTTGCATCTCG, ATGGTATGCAGATAGGTATGAGG, which resulted in a Exon Deletion. (J:265051)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

3 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Nup155 Mutation: 94 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 4 reference(s)