Rb1cc1^em1(IMPC)Mbp
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rb1cc1^em1(IMPC)Mbp
• Name: RB1-inducible coiled-coil 1; endonuclease-mediated mutation 1, Mouse Biology Program, UC Davis
• MGI ID: MGI:6277004
• Gene: Rb1cc1 Location: Chr1:6284858-6346599 bp, + strand Genetic Position: Chr1, 1.89 cM, cytoband A2
• Alliance: Rb1cc1^em1(IMPC)Mbp page
• IMPC: Rb1cc1 gene page

Mutation origin

• Strain of Origin: C57BL/6NCrl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Not Specified)
• Mutation: Intragenic deletion
• Mutation details: This allele from IMPC was generated at UC Davies by injecting CAS9 Protein and 3 guide sequences CCTCTACTTAAGAGTCGGGTTGA, CTACTTAAGAGTCGGGTTGAGGG, CCTTAGAATGAAATTCAGTAGTC, which resulted in a Inter-exdel deletion. (J:265051)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

5 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Rb1cc1 Mutation: 84 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 3 reference(s)