Dlst^{em1(IMPC)Hmgu}
Endonuclease-mediated Allele Detail

Summary

• Symbol: Dlst^{em1(IMPC)Hmgu}
• Name: dihydrolipoamide S-succinyltransferase; endonuclease-mediated mutation 1, Helmholtz Zentrum Muenchen GmbH
• MGI ID: MGI:6277023
• Gene: Dlst Location: Chr12:85157597-85180865 bp, + strand Genetic Position: Chr12, 39.55 cM, cytoband D3
• Alliance: Dlst^{em1(IMPC)Hmgu} page
• IMPC: Dlst gene page

Mutation origin

• Strain of Origin: C57BL/6N
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele from IMPC was generated at Helmholtz-Zentrum Muenchen by injecting CAS9 Protein and 4 guide sequences TACCACCTTGCTATAATAGTTGG, GGCATATCTGCGTGCTGCAGAGG, GTTAAAGAAACCTAATTGGGAGG, TCCTCGGCTCCAAGGGGGTAGGG, which resulted in a Exon Deletion. (J:265051)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Dlst Mutation: 17 strains or lines available

References

• Original: J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023
• All: 3 reference(s)