About   Help   FAQ
H4c16em1(IMPC)Mbp
Endonuclease-mediated Allele Detail
Summary
Symbol: H4c16em1(IMPC)Mbp
Name: H4 histone 16; endonuclease-mediated mutation 1, Mouse Biology Program, UC Davis
MGI ID: MGI:6277028
Gene: H4c16  Location: Chr6:136780991-136781429 bp, - strand  Genetic Position: Chr6, 66.72 cM, cytoband G1
Alliance: H4c16em1(IMPC)Mbp page
IMPC: H4c16 gene page
Mutation
origin
Strain of Origin:  C57BL/6NCrl
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Deletion
 
Mutation detailsThis allele from IMPC was generated at UC Davies by injecting CAS9 Protein and 2 guide sequences AGCAGGTCCCAGGCGGTAGGCGG, GAGCTTATATTTCCTGGGAGCGG, which resulted in a Whole-gene deletion. (J:265051)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any H4c16 Mutation:  8 strains or lines available
References
Original:  J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
10/29/2024
MGI 6.24
The Jackson Laboratory