Poglut3^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Poglut3^em1(IMPC)J
• Name: protein O-glucosyltransferase 3; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6277997
• Gene: Poglut3 Location: Chr9:53295325-53313167 bp, + strand Genetic Position: Chr9, 29.12 cM
• Alliance: Poglut3^em1(IMPC)J page
• IMPC: Poglut3 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GCAAGGATCTGACTTAACAT and TTGCTGTAAGATTTAGGTTG, which resulted in a 2694 bp deletion beginning at Chromosome 9 position 53,388,204 bp and ending after 53,390,897 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000278889 and ENSMUSE00000278863 (exons 2 and 3) and 2209 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 63 and early truncation 22 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Poglut3 Mutation: 19 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 2 reference(s)