Atpsckmt^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Atpsckmt^em1(IMPC)J
• Name: ATP synthase C subunit lysine N-methyltransferase; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6278547
• Synonyms: Atpsckmt^-
• Gene: Atpsckmt Location: Chr15:31601998-31621373 bp, + strand Genetic Position: Chr15, 13.02 cM
• Alliance: Atpsckmt^em1(IMPC)J page
• IMPC: Atpsckmt gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences GAGCACACACTAGAAAGCCA and GACTCTGAACACATGCTGGT, which resulted in a 592 bp deletion beginning at Chromosome 15 position 31,605,842 bp and ending after 31,606,433 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001310278 (exon 2) and 314 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 5 and early truncation 13 amino acids later. In addition, there is a 2 bp deletion (GT) 36 bp after the 592 bp deletion. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Atpsckmt Mutation: 26 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)