About   Help   FAQ
Eno2em1(IMPC)H
Endonuclease-mediated Allele Detail
Summary
Symbol: Eno2em1(IMPC)H
Name: enolase 2, gamma neuronal; endonuclease-mediated mutation 1, Harwell
MGI ID: MGI:6279897
Gene: Eno2  Location: Chr6:124737018-124746489 bp, - strand  Genetic Position: Chr6, 59.17 cM
Alliance: Eno2em1(IMPC)H page
IMPC: Eno2 gene page
Mutation
origin
Strain of Origin:  C57BL/6NTac
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from IMPC was generated at Medical Research Council Harwell by injecting CAS9 RNA and 4 guide sequences CCCACCCTTGCAGTGTAAAAACA, AGACTCCACAATCCAGCCTTGGG, GGAATCTTGAGTTCGTGCGGGGG, GAGCCTGAATCCACGAGCCAAGG, which resulted in a Exon Deletion. (J:265051)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Eno2 Mutation:  55 strains or lines available
References
Original:  J:265051 MGI and IMPC, MGI Load of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). Database Release. 2018-2023;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/10/2024
MGI 6.24
The Jackson Laboratory